A practical reference on research chemical: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
This page was last updated on 2026-08-01 and is reviewed periodically as new material appears.
Quality assessment for cardarine samples usually combines identity, purity, and impurity testing. Nuclear magnetic resonance spectroscopy and mass spectrometry can confirm molecular structure, while high-performance liquid chromatography estimates purity. Certificates of analysis from testing laboratories may list these results, but they do not establish safety or legality. In the absence of approved manufacturing, products sold online may contain the wrong compound, variable amounts, or unlisted contaminants. Independent verification is therefore central to analytical work and to interpreting any reported biological activity.
Laboratory detection of GW501516 commonly uses liquid chromatography coupled with tandem mass spectrometry. The method can identify the parent compound or its metabolites in urine and blood after sample cleanup. Protein precipitation, solid-phase extraction, or enzymatic hydrolysis may precede analysis, depending on the matrix. Reference standards are required for accurate quantification and confirmation. Because the compound is not approved, testing often occurs in anti-doping, forensic, or research settings rather than routine clinical care. Results are reported with limits of detection and quantification.
The pharmacological interest in cardarine centers on PPARδ activation and its downstream effects on lipid handling and mitochondrial function. In animal studies, PPARδ agonists have been associated with changes in exercise endurance and fatty acid utilization, though results vary by model and protocol. Human data remain sparse, and the absence of large controlled trials limits conclusions about efficacy. Researchers often describe the compound as a tool for probing PPARδ biology rather than a proven therapeutic agent.
Safety discussions about cardarine frequently cite rodent carcinogenicity findings reported in the 2000s. In those studies, treated animals developed tumors at multiple sites, leading sponsors to discontinue clinical development. The relevance of these findings to humans has not been resolved, but they are a major reason the compound is not approved. Current literature emphasizes uncertainty about long-term effects and the risks of unregulated use. Regulators and health agencies have not established a safe human exposure level.
Cardarine is a synthetic compound also known as GW501516, GW-501516, and sometimes endurobol. It was developed as a selective agonist of peroxisome proliferator-activated receptor delta, a nuclear receptor involved in fatty acid oxidation and energy metabolism. The compound was studied in preclinical models for metabolic and cardiovascular conditions, but it did not become a marketed human medicine. In regulatory and anti-doping contexts, it is treated as a prohibited substance rather than a licensed medicine.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white powder | Common for reference-grade material. |
| Solubility | Low in water | Dissolves in DMSO and some organic solvents. |
| Typical storage | -20 °C, desiccated | Protect from light and moisture. |
| Analytical method | LC-MS/MS | Used for trace detection in biological matrices. |
| Purity assessment | HPLC with UV detection | Often combined with NMR and mass spectrometry. |
Cardarine is the common name for GW501516, a synthetic compound studied as a peroxisome proliferator-activated receptor delta agonist. Researchers developed it to explore treatments for lipid disorders and metabolic conditions. It is not an approved medicine in any country. Early clinical work examined changes in HDL cholesterol and triglycerides, but development was discontinued after animal studies raised concerns about cancer. The compound remains available as a research chemical and appears in discussions of performance enhancement.
At the molecular level, GW501516 binds and activates PPARδ, a nuclear receptor that regulates transcription. Activation shifts expression of genes involved in fatty acid oxidation, energy expenditure, and lipid transport in skeletal muscle and liver. Animal studies report increased endurance and altered lipid profiles after exposure. Human data are limited to small trials and do not establish long-term safety or efficacy. PPARδ also has roles in cell proliferation, so the relationship between activation and cancer risk remains an open question.
Sporting authorities added GW501516 to prohibited lists after it appeared in athlete samples and online markets. The World Anti-Doping Agency classifies it as a hormone and metabolic modulator, and its use can lead to an anti-doping rule violation. Some early laboratory work suggested effects on fatty acid oxidation and endurance-related metabolism in animals, but those findings do not establish safe or effective use in people. Reports of adverse events in humans are scarce and often anecdotal, which complicates risk assessment.
Legal status varies by country. In some places, cardarine is controlled under medicines or psychoactive substances laws; in others, it may be sold with minimal oversight as a research chemical. Customs agencies have intercepted shipments, and several national health agencies have issued warnings about products marketed for bodybuilding or performance enhancement. The lack of a standardized pharmaceutical supply means identity, purity, and contamination levels can differ widely between samples. These factors make cardarine a regulatory and public health concern rather than a conventional prescription drug.
Cardarine is a common name for GW501516, a synthetic compound first described in the 1990s as a selective agonist of the peroxisome proliferator-activated receptor delta. It was studied in preclinical models for metabolic and cardiovascular conditions, but it has not been approved as a medicine in the United States, Europe, or other major jurisdictions. Retail products labeled as cardarine are generally research chemicals or supplements, not pharmaceutical formulations. Because human safety and efficacy data remain limited, regulatory agencies treat it as an unapproved substance rather than a therapeutic product.
Cardarine can be detected in biological samples and product materials using liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS). The method separates compounds by chromatography and identifies them by mass-to-charge transitions, allowing low-level detection in urine or blood. Sample preparation often involves enzymatic hydrolysis, solid-phase extraction, or protein precipitation. Certified reference materials and isotope-labeled internal standards improve quantification. Detection windows depend on metabolism, matrix, and assay sensitivity, so no single universal window applies.
Regulatory treatment of cardarine differs by context and jurisdiction. In competitive sport, the World Anti-Doping Agency lists PPARδ agonists, including GW501516, as prohibited at all times. Outside sport, it lacks approval as a prescription medicine in major drug markets, and products sold for human consumption may be treated as unapproved drugs. Some countries also restrict importation or sale through general consumer protection and medicines laws. These classifications affect availability, testing, and legal risk without establishing therapeutic value.
Because cardarine is not an approved medicine, no pharmacopeial monograph defines its identity, purity, or storage requirements. Laboratories typically rely on in-house methods and reference standards when testing materials labeled as GW501516. Certificates of analysis may report purity and identity for a specific batch, but their scope varies and they do not guarantee safety or legal status. Independent verification can include high-performance liquid chromatography, mass spectrometry, nuclear magnetic resonance, and elemental analysis. The distinction between research chemical labeling and human use is significant because quality standards and oversight differ.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
He further dismissed India's firm stance on pursuing terrorists as a “new abnormal,” stating it did not serve the interests of either country. Bilawal Zardari faced strong criticism from the Pakistan Tehreek-e-Insaf (PTI) following his remarks suggesting that Pakistan could extradite “individuals of concern” to India as a confidence-building measure. PTI Central Information Secretary Sheikh Waqas Akram condemned the statement as undermining national security and appeasing a "hostile neighbour", calling him an “immature political child” and accusing him of lacking understanding of regional geopolitics. Akram argued that such proposals compromised Pakistan’s sovereignty and contradicted the legacy of the Pakistan Peoples Party, particularly on the Kashmir issue. He further criticized Bilawal Zardari’s political credibility and called for a leadership change within the party. Talha Saeed, son of Hafiz Saeed, condemned Bilawal Zardari remarks on the possible extradition of Pakistani citizens to India, calling them contrary to state policy and national interest, and defended his father by asserting that none of his actions were against Pakistan.
=== Ethnicity === Kashmiris, Dogras, and Gurjars are three major ethnolinguistic groups of Jammu and Kashmir. The Gurjar community constitute more than 20% of Jammu and Kashmir's total population. Kashmiris form the majority in the Kashmir division, while Dogras form the majority in the Jammu division. Paharis also form a significant population, mainly in the southern parts of Jammu division. In 2024, the Government of India granted Scheduled Tribe status to the Paharis. In Jammu and Kashmir around 924,485 people (7.5% of the population) belong to scheduled castes (SC). More than 18.5% of the population belongs to the scheduled tribes (ST), and 11.4% are classified as Other Backward Classes (OBC). Forward Caste groups make up 62.5% of the population. The SCs are mostly concentrated in the Jammu division. The Gurjar and Bakarwal are the largest Scheduled Tribe of Jammu and Kashmir and they make up 69%-72% of the ST population.
Hydrothermal vent ecosystems have enormous biomass and productivity, but this rests on the symbiotic relationships that have evolved at vents. Deep-sea hydrothermal vent ecosystems differ from their shallow-water and terrestrial hydrothermal counterparts due to the symbiosis that occurs between macroinvertebrate hosts and chemoautotrophic microbial symbionts in the former. Since sunlight does not reach deep-sea hydrothermal vents, organisms in deep-sea hydrothermal vents cannot obtain energy from the sun to perform photosynthesis. Instead, the microbial life found at hydrothermal vents is chemosynthetic; they fix carbon by using energy from chemicals such as sulfide, as opposed to light energy from the sun. In other words, the symbiont converts inorganic molecules (H2S, CO2, O) to organic molecules that the host then uses as nutrition. However, sulfide is an extremely toxic substance to most life on Earth. For this reason, scientists were astounded when they first found hydrothermal vents teeming with life in 1977. What was discovered was the ubiquitous symbiosis of chemoautotrophs living in (endosymbiosis) the vent animals' gills; the reason why multicellular life is capable to survive the toxicity of vent systems. Scientists are therefore now studying how the microbial symbionts aid in sulfide detoxification (therefore allowing the host to survive the otherwise toxic conditions). Work on microbiome function shows that host-associated microbiomes are also important in host development, nutrition, defense against predators, and detoxification.
Sources: en.wikipedia.org
4 Cyt c2+ + O2 + 8 H+(inside) → 4 Cyt c3+ + 2 H2O + 4 H+(outside) Although the heme proteins are the most important class of iron-containing proteins, the iron–sulfur proteins are also very important, being involved in electron transfer, which is possible since iron can exist stably in either the +2 or +3 oxidation states. These have one, two, four, or eight iron atoms that are each approximately tetrahedrally coordinated to four sulfur atoms; because of this tetrahedral coordination, they always have high-spin iron. The simplest of such compounds is rubredoxin, which has only one iron atom coordinated to four sulfur atoms from cysteine residues in the surrounding peptide chains. Another important class of iron–sulfur proteins is the ferredoxins, which have multiple iron atoms. Transferrin does not belong to either of these classes. The ability of sea mussels to maintain their grip on rocks in the ocean is facilitated by their use of organometallic iron-based bonds in their protein-rich cuticles. Based on synthetic replicas, the presence of iron in these structures increased elastic modulus 770 times, tensile strength 58 times, and toughness 92 times. The amount of stress required to permanently damage them increased 76 times.
Nerves are responsible for controlling the contraction of muscles, determining the number, sequence and force of muscular contraction. Most movements require a force far below what a muscle could potentially generate, and nervous fatigue is seldom an issue. But, during extremely powerful contractions that are close to the upper limit of a muscle's ability to generate force, nervous fatigue (enervation) — in which the nerve signal weakens — can be a limiting factor in untrained individuals. In novice strength trainers, the muscle's ability to generate force is most strongly limited by nerve's ability to sustain a high-frequency signal. After a period of maximum contraction, the nerve's signal reduces in frequency and the force generated by the contraction diminishes. There is no sensation of pain or discomfort, the muscle appears to simply 'stop listening' and gradually cease to contract, often going backwards. Often there is insufficient stress on the muscles and tendons to cause delayed onset muscle soreness following the workout. Part of the process of strength training is increasing the nerve's ability to generate sustained, high frequency signals which allow a muscle to contract with its greatest force. This neural training can cause several weeks of rapid gains in strength, which level off once the nerve is generating maximum contractions and the muscle reaches its physiological limit. Past this point, training effects increase muscular strength through myofibrillar or sarcoplasmic hypertrophy and metabolic fatigue becomes the factor limiting contractile force.
Malaysia's cuisine reflects the multi-ethnic makeup of its population. Many cultures from within the country and from surrounding regions have greatly influenced the cuisine. Much of the influence comes from the Malay, Chinese, Indian, Thai, Javanese, and Sumatran cultures, largely due to the country being part of the ancient spice route. The cuisine is similar to those of Singapore and Brunei, and also bears resemblance to Filipino cuisine. The different states have varied dishes, and often the food in Malaysia is different from the original dishes. Sometimes food not found in its original culture is assimilated into another; for example, Chinese restaurants in Malaysia often serve Malay dishes. Food from one culture is sometimes also cooked using styles taken from another culture, For example, sambal belacan (shrimp paste) are commonly used as ingredients by Chinese restaurants to create the stir fried water spinach (kangkung belacan). This means that although much of Malaysian food can be traced back to a certain culture, they have their own identity. Rice is a staple food and an important constituent of the country's culture. Chili is commonly found in local cuisine, although this does not necessarily make them spicy.
Sources: en.wikipedia.org
== Bibliography == Barrow, Logie; Bullock, Ian (1996). Democratic Ideas and the British Labour Movement, 1880–1914. Cambridge University Press. ISBN 9780521560429. Benn, Tony (1980). Arguments for Socialism. Penguin. ISBN 9780140054897. Dorrien, Gary (2019). Social Democracy in the Making: The Political and Religious Roots of European Socialism. Yale University Press. ISBN 9780300236026. Draper, Hal (1966). "The Two Souls of Socialism". New Politics. 5 (1): 57–84. Harrington, Michael (1989). Socialism: Past and Future. Arcade Publishing. ISBN 9781559700009. Hatterlsey, Roy (1987). Choose Freedom: The Future of Democratic Socialism. Penguin. ISBN 0140104941. Doherty, James C.; Lamb, Peter (2006). Historical Dictionary of Socialism (2nd ed.). The Scarecrow Press. ISBN 9780810855601. Miliband, Ralph (1994). Socialism for a Sceptical Age. London, United Kingdom: Polity Press. ISBN 9780745614274. Reisman, Reidsman, ed. (1996). Democratic Socialism in Britain: Classic Texts in Economic and Political Thought, 1825–1952. Chatto and Pickering. ISBN 9781851962853. Thomas, Norman (1953). Democratic Socialism: A New Appraisal. League for Industrial Democracy. ASIN B0007ECO76. Tomlinson, Jim (1997). Democratic Socialism and Economic Policy: The Attlee Years, 1945–1951. Cambridge University Press. ISBN 0521550955.
It has been named a Rising Star among journals in the field of Immunology in Essential Science Indicators from Thomson Reuters for several months during 2010 and 2011. CVI's impact factor has increased steadily for the last five years.
== Pharmacokinetics == A cross-over study in six healthy volunteers (median age 28 years) was conducted using single-dose pharmacokinetics of 5 mg clotiazepam drops, oral tablets, and sublingual tablets. The formulations had similar systemic availability. Compared with oral tablets, the sublingual route gave a lower peak concentration and a delayed peak time, while drops gave a greater maximum concentration with a similar peak time. The use of drops is suggested for a more marked initial effect and the sublingual route for easier administration, especially in the elderly.
=== Scaffolding === In 2013, using a 3D scaffolding of Matrigel in various configurations, substantial pancreatic organoids was produced in vitro. Clusters of small numbers of cells proliferated into 40,000 cells within one week. The clusters transform into cells that make either digestive enzymes or hormones like insulin, self-organizing into branched pancreatic organoids that resemble the pancreas. The cells are sensitive to the environment, such as gel stiffness and contact with other cells. Individual cells do not thrive; a minimum of four proximate cells was required for subsequent organoid development. Modifications to the medium composition produced either hollow spheres mainly composed of pancreatic progenitors, or complex organoids that spontaneously undergo pancreatic morphogenesis and differentiation. Maintenance and expansion of pancreatic progenitors require active Notch and FGF signaling, recapitulating in vivo niche signaling interactions. The organoids were seen as potentially offering mini-organs for drug testing and for spare insulin-producing cells. Aside from Matrigel 3D scaffolds, other collagen gel systems have been developed. Collagen/hyaluronic acid scaffolds have been used for modeling the mammary gland In Vitro while co-coculturing epithelial and adipocyte cells. The HyStem kit is another 3D platform containing ECM components and hyaluronic acid that has been used for cancer research. Additionally, hydrogel constituents can be chemically modified to assist in crosslinking and enhance their mechanical properties.
Sources: en.wikipedia.org
LC-MS/MS is common, often after sample cleanup. The assay targets GW501516 or its metabolites.
Reference material is usually kept cold, dry, and protected from light. Frozen aliquots reduce repeated freeze-thaw cycles.
No approved pharmaceutical product exists, so manufacturing and quality controls are not standardized. Products may contain different compounds or impurities.
Cardarine is an investigational synthetic compound that acts as a PPARδ agonist. It is also known as GW501516 and has been studied mainly in preclinical research. It is not an approved medicine.